,

ssDNA (TTATT-5C) Cas12a Reporter 6

$175.00

  • Reporter ssDNA for Cas12a lateral flow systems
  • Concentration: 2uM
  • Volume: 100ul mL
  • Storage Conditions: Store at 2C – 8C
  • Supplied in: TE with 0.05% Sodium Azide.

- +
SKU: PN2103 Categories: , Tags: , , ,

The 100ul of a 2uM solution of a single-stranded DNA (ssDNA) reporter 56-FAM/ATTTATTTATTTATTTACCCCC/3BIOTEG (often repeated or used as a canonical short motif) is a standard universal lateral flow test kits widely utilized in CRISPR/Cas12a-based nucleic acid detection assays like DETECTR.  Also compatable with Attogene Universal Lateral FLow Assay kits  such as all AU2034 version kits.

For larger sizes contact us: sales@attogene.com

You may also like…

Shopping Cart