Universal 23s PCR Amplification Kit (For cyanobacteria species identification)

The 23S ribosomal RNA (rRNA) is a crucial component of the bacterial/archean ribosome. The 23S rRNA is a 2,904-nucleotide long component of the large subunit (50S) of the ribosome. Compared to 16S rRNA genes, 23S rRNA genes have greater sequence variations due to unique insertions, deletions, and length.

Attogene’s 23s PCR kit is designed for identification of specific strains of bacterial/archean using the ribosomal RNA gene region for use in Phylogenetic studies of bacterial diversity from environmental DNA samples such as water.

For example, a sample of algae is obtained and washed to extract a clean algal genomic DNA (gDNA) sample. A reaction mixture is assembled from primers, master mix, and gDNA samples as required. The qPCR machine of choice is set up and loaded as needed and the mixture undergoes PCR amplification. The Primer mix provided exploits the Taq polymerase to amplify the gene region of interest.

Fragment Size: 874bp – effective primer set for nanopore sequencing species identification.

Forward primer: 5’- AGGGGTAAAGCACTGTTTCG -3′

Reverse primer: 5’- CCTTCTCCCGAAGTTACG -3′

Primer mix of 10uM – 150ul

PCR water -1mL