Universal 23s PCR Amplification Kit (For cyanobacteria species identification)

$350.00

In Stock & Ready to Ship

  • This kit is sufficient for 150 reactions:
  • For characterizing cyanobacteria in environmental samples
  • Use in combination with Attogene Algae DNA isolation kit
  • Universal 23s PCR primers
  • Perfect for Environmental DNA (eDNA) Characterization
SKU: NA2028 Categories: , Tags: ,
Share:
Compare

The 23S ribosomal RNA (rRNA) is a crucial component of the bacterial/archean ribosome. The 23S rRNA is a 2,904-nucleotide long component of the large subunit (50S) of the ribosome. Compared to 16S rRNA genes, 23S rRNA genes have greater sequence variations due to unique insertions, deletions, and length.

Attogene’s 23s PCR kit is designed for identification of specific strains of bacterial/archean using the ribosomal RNA gene region for use in Phylogenetic studies of bacterial diversity from environmental DNA samples such as water.

For example, a sample of algae is obtained and washed to extract a clean algal genomic DNA (gDNA) sample. A reaction mixture is assembled from primers, master mix, and gDNA samples as required. The qPCR machine of choice is set up and loaded as needed and the mixture undergoes PCR amplification. The Primer mix provided exploits the Taq polymerase to amplify the gene region of interest.

Fragment Size: 874bp – effective primer set for nanopore sequencing species identification.

Forward primer: 5’- AGGGGTAAAGCACTGTTTCG -3′

Reverse primer: 5’- CCTTCTCCCGAAGTTACG -3′

Primer mix of 10uM – 150ul

PCR water -1mL

You may also like…

Microcystin qPCR Detection Kit (real-time PCR kit for MycE Cluster)

$350.00

This kit is sufficient for 150 reactions:

  • Real time qPCR kit
  • For screening microcystin gene cluster
  • Use in combination with Attogene Algae DNA isolation kit

Compatible with automated systems.

Plant and Algae RNA Isolation Kit

$424.00

This kit is sufficient for 100 RNA isolations based on:

  • 200mg fresh plant
  • 1ml algae culture
  • 50mg dry seeds.

Compatible with automated systems.